Home Current issue Ahead of print Search About us Editorial board Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 39  |  Issue : 2  |  Page : 364-370

Study the association among human papilloma virus subtypes 16 and 18, codon 72 P53 gene polymorphism, and oral squamous cell carcinoma in Upper Egypt: a case–control study


1 Department of General Surgery, Maxillofacial Unit, Assiut University Hospital, Assiut, Egypt
2 Department of Anatomy, College of Medicine, Jouf University, Al-Jawf; Department of Histology and Cell Biology, Faculty of Medicine, Assiut University, Assiut, Kingdom of Saudi Arabia
3 Department of Pathology, Faculty of Medicine, Assiut University, Assiut, Egypt

Date of Submission05-Dec-2019
Date of Acceptance23-Dec-2019
Date of Web Publication27-Apr-2020

Correspondence Address:
MBBCh, MSc, Assistant Lecturer Hamdan S Abbas
Department of General Surgery, Maxillofacial Unit, Assiut University Hospital, Faculty of Medicine, Assiut University, El-Gamaa Street, Assiut 71515
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ejs.ejs_215_19

Rights and Permissions
  Abstract 


Objectives To investigate the possible association among oral squamous cell carcinoma (OSCC), human papilloma virus (HPV) subtypes 16 and 18, and P53 codon 72 genotypes in Upper Egypt population.
Patients and methods The present case–control study included patients presented to Maxillofacial Unit, General Surgery Department, Faculty of Medicine at Assiut University Hospital, Egypt. The biopsies were collected from patients with OSCC, patients with leukoplakia, and healthy oral mucosa as a control group. The P53c72 genotypes and gene expression for HPV subtypes 16 and 18 were determined using the real-time PCR method.
Results The study was done on 69 patients: 45 cases (28 OSCC cases and 17 leukoplakia cases) and 24 patients as a control group. There was no statistically significant association between both OSCC and leukoplakia and P53 codon 72 gene polymorphism. The distribution of P53 genotypes in patients with OSCC was 21.4% were wild, 39.3% were mutant, and 39.3% were heterogeneous, whereas in leukoplakia, 23.6% were wild, 17.6% were mutant, and 58.8% were heterogeneous when compared with controls, where 45.8% were wild,12.5% were mutant, and 41.7% were heterogeneous.
Conclusion No statistically significant correlation between HPV 16 and 18 genotypes and OSCC in the present study could be noted. Moreover, there is no association between codon 72 of P53 gene polymorphism and OSCC, so other environmental factors should be studied to detect the causal factors of oral carcinoma in our society.

Keywords: human papilloma virus, leukoplakia, oral squamous cell carcinoma, P53 codon 72 single nucleotide polymorphism


How to cite this article:
Shaltout SDG, El-Dein HM, Elsers DA, Shahine MS, Abbas HS, Osman MH. Study the association among human papilloma virus subtypes 16 and 18, codon 72 P53 gene polymorphism, and oral squamous cell carcinoma in Upper Egypt: a case–control study. Egypt J Surg 2020;39:364-70

How to cite this URL:
Shaltout SDG, El-Dein HM, Elsers DA, Shahine MS, Abbas HS, Osman MH. Study the association among human papilloma virus subtypes 16 and 18, codon 72 P53 gene polymorphism, and oral squamous cell carcinoma in Upper Egypt: a case–control study. Egypt J Surg [serial online] 2020 [cited 2020 May 30];39:364-70. Available from: http://www.ejs.eg.net/text.asp?2020/39/2/364/283191




  Introduction Top


Globally, more than 350 000 oral cancer cases are diagnosed every year; moreover, the prevalence differs according to geographic distribution [1]. In Egypt, ∼4500 cases are diagnosed every year, with a 50% mortality rate [2]. Despite recent advances in surgical resection, adequate chemotherapy, and radiotherapy, the 5-year survival rate was less than 65% over the world [3]. Therefore, emphasis should be focused on prevention of oral cancer through the study of its etiology [4].

P53 is a tumor-suppressor gene which protects human cells from malignancy by repair damaged DNA and by inducing apoptosis causing cell cycle arrest [5]. Recently, there is great interest on the study of the association of P53 polymorphisms and cancer risks. There are 13 polymorphisms described in this gene [6]. The most frequently studied one is a single nucleotide polymorphism (SNP) at codon 72 in exon 4, which results in the replacement of arginine by proline in the trans-activating domain (rs1042522) [7].

For this SNP, the G allele encodes an arginine (CGC) at position 72 of the protein, where there is normally a proline (CCC), resulting in minor allele homozygote (C; C), called Pro/Pro genotype, or major allele homozygote (G; G), called Arg/Arg genotype, or heterozygote variant (G; C), called Arg/Pro genotype. Comparative sequence analyses indicate that the Pro allele is the ancestral form [8]. These variants exhibit different biochemical properties, resulting in differences in the ability of each variant to stimulate target gene expression [9].

Human papilloma virus (HPV), especially subtypes 16 and 18 and rarely 31 and 33 are other important risk factors in oral cancer [10]. Some studies found an association between HPV and P53 gene mutation, as HPV expresses two viral proteins (E6 and E7 proteins) that bind to the P53 gene, causing its mutation and malignant transformation [11].

Leukoplakia is the most frequent precancerous oral lesion [12]. It represents 85% of these precancerous lesions [13].

The rate of malignant transformation of leukoplakia depends on many parameters like DNA ploidy, P53 expression, and HPV subtypes [14].

To our knowledge, there is limited access to similar researches. So, the current study aims to investigate the association between oral squamous cell carcinoma (OSCC), precancerous lesions, and HPV (subtypes 16 and 18), codon 72 of P53 SNP as a tool for prevention and/or prediction of oral cancer.


  Patients and methods Top


The current case–control study was done on patients presented to Maxillofacial Unit, General Surgery Department at Assiut University Hospital, Egypt. The ethical review board of Assiut Faculty of Medicine approved the study. The group of cases consisted of all patients with OSCC and leukoplakia registered from March 2016 to December 2018 in the area of the study. All cases are revised and approved by the pathologist. The control group is obtained from the healthy oral mucosa of patients presented to the trauma unit of Assiut University Hospital with soft tissue injury of the oral cavity.

Eligible participants

The study included patients with OSCC and oral leukoplakia who were diagnosed by a pathologist. Personal data such as age, sex, smoking status, and education level, of each participant were included in the study. The study excluded other pathological types of oral cancer, and other types of oral precancerous lesions were excluded from the study.

Intervention

Biopsy

All specimens were obtained from the participants by incisional biopsy from oral tissues where samples were immediately frozen in liquid nitrogen within 30 min of biopsy and stored at −80°C until use. Pathological diagnoses were reviewed by the pathologist ([Figure 1] and [Figure 2]).
Figure 1 Hematoxylin and eosin-stained section from squamous cell carcinoma revealed the presence of malignant squamous cells arranged in nests with keratin pearls surrounded by desmoplastic stroma (×20).

Click here to view
Figure 2 Hematoxylin and eosin-stained section revealed the presence of leukoplakia with mild dysplasia (×10).

Click here to view


DNA extraction

DNA extraction from oral tissue was performed using Clamp DNA Mini Kit 50 Cat. no. 51304 (Qiagen) with all recommended by the manufacturer. DNA concentration is determined using Spectrostar Nano (BMG Lab Tech, Franc). The constant concentration is 20 ng.

P53 genotyping

Genotyping was performed using Real-Time PCR (Applied Biosystem, 7 Kingsland Grange-Woolston, Warrington, Cheshire, UK, Step One plus), and the thermal profile was 60° for 30s, 95° for 10 min, 95° for 15s, and 60° for 90 s, for SNP (rs1042522). NCBI shows the type of polymorphism (A/C/G). C is the ancestral allele, and G is the mutant allele. Thermo Fischer shows that C is Vic (allele 1) G is fam (allele 2).

Context Sequence [VIC/FAM]: AGGAGCTGCTGGTGCAGGGGCCACG[C/G]GGGGAGCAGCCTCTGGCATTCTGGG

PCR for human papilloma virus 16 and 18

DNA extraction from oral tissue was performed using Qlamp DNA Mini Kit 50 T, Cat. no. 51304 (Qiagen), according to the manufacturer instructions. The DNA concentration was determined using Spectrostar Nano (Lab Tech), at a constant concentration of 20 ng. Gene expression was performed using Applies Biosystem Step One Plus real-time PCR; the thermal profile was 60° for 30s, 95° for 10 min, 95° for 15s, and 60° for 90 s. The primer and probe sequences for HPV 16 and 18 are shown in [Table 1].
Table 1 The probe-primer sequences for human papilloma virus 16 and 18 used in real-time PCR

Click here to view


Study outcomes

The primary outcomes of the current study were to know the percentage of patients with OSCC and oral leukoplakia having P53 codon 72 gene polymorphism to study the possible association between OSCC and P53 codon 72 genotypes. So, persons with genetic susceptibility can be identified and undergo close follow-up for early detection. The secondary outcome was to know the percentage of patients with squamous cell carcinoma (SCC) infected with HPV subtypes 16 and 18, so that vaccination could be developed against HPV if a positive association was detected, and early treatment of highly susceptible persons.

Statistical analysis

Data analysis was accomplished using the Statistical Package for the Social Sciences software program (SPSS Inc., USA), version 21. Statistical significance was acceptable to a level of P value less than 0.05. Quantitative data were represented by mean and SD, whereas qualitative data were represented by number and percentage. The study outcomes were analyzed using c2 test, Fisher exact test, and independent samples t test.


  Results Top


The study was done on 69 patients, comprising 28 (40.6%) OSCC cases, 17 (24.6%) cases of leukoplakia, and 24 (34.8%) samples as a control group.

Demographic data for the selected risk factors are shown in [Table 2], in which 14 (50.0%) cases of OSCC were males and 14 (50.0%) cases were females, with no statistically significant difference when compared with control group (P=0.548). However, in leukoplakia, 16 (94.1%) cases were males and one (5.9%) case were female, with a statistically significant difference when compared with the control group (P=0.014).
Table 2 Demographic details for selected data for oral squamous cell carcinoma, leukoplakia, and control

Click here to view


The present study showed that the frequency of OSCC was higher in nonsmokers (64.3%), whereas in leukoplakia, there were a significant association between leukoplakia and smoking, as 15 (88.2%) cases were smokers and two (11.8%) cases were nonsmokers, with statistically significant difference when compared with the control group (P=0.000).

As shown in [Table 3] and [Table 4], distribution of P53 genotypes and HPV 16 and 18 in patients with OSCC, patients with leukoplakia, and controls, it was observed that three (4.3%) cases were positive for HPV 16 (one (1.4%) case of OSCC, and two (2.9%) cases of leukoplakia), whereas all cases were negative for HPV 18 compared with controls, with negative results for both HPV 16 and 18. It was observed that there was no significant association between HPV 16 and OSCC or leukoplakia when compared with the control group (P=1.00 and 0.166, respectively).
Table 3 Distribution of P53 genotypes in patients with oral squamous cell carcinoma, patients with leukoplakia, and controls

Click here to view
Table 4 Human papilloma virus subtypes 16 and 18 in patients with oral squamous cell carcinoma, patients with leukoplakia, and controls

Click here to view


We also observed that there was no statistically significant association between OSCC or leukoplakia and P53 codon 72 gene polymorphism.

As shown in [Table 5], we also stratified the associations between codon 72 P53 SNP genotypes and age, sex, smoking, education level, site of lesion, staging, grading of OSCC, grading of leukoplakia, and HPV 16 to study the correlations between codon 72 P53 SNP genotyping and the clinicopathological features of both OSCC and leukoplakia.
Table 5 The clinicopathological features of the patients with oral squamous cell carcinoma according to codon 72 P53 single nucleotide polymorphism genotyping (N=69)

Click here to view


On studying the interaction of all previous factors, there was no statistically significant association between them and codon 72 P53 genotypes.

By classifying education level into two groups (literate and illiterate), we observed that the high frequency of mutant genotypes was found in the illiterate group, with a statistically significant difference compared with the literate group (P=0.047).

By using the TNM staging system for OSCC, it was observed that stage II OSCC had the highest frequency in both mutant and heterogeneous genotypes, with a statistically significant difference compared with other stages (P=0.000).

It was observed that moderate differentiated OSCC had the highest frequency in both mutant and heterogeneous genotypes, with a statistically significant difference compared with other grades (P=0.002) ([Figure 2]).


  Discussion Top


OC etiology is multifactorial [15]. Numerous risk factors contribute to its etiology, which includes genetic variation and environmental factors such as smoking, alcohol drinking, and viral infections [16],[17]. Previous reports show that TP53 mutation may contribute to OC tumorigenesis [18]. On the contrary, other studies implied that mutation of TP53 gene has been supposed to be an uncommon event in carcinogenesis of oral carcinoma [19],[20].

In the present study, there was no significant association between codon 72 of the P53 gene polymorphism and OSCC. These results were similar to the results gained by Shen et al. [21] on head and neck SCC, as well as the study in northern Iran [22].

In the previous studies on codon 72 of P53 SNP, Arg variant has been believed to increase susceptibility to gastric [23] and breast carcinoma [24]. The Arg72 homozygosity was associated with cervical cancer [25]. Conversely, Pro homozygosity was associated with the lung [26] and hepatocellular cancer [27]. The heterozygous genotype has been accused to increase the risk of bladder cancer [28].

In studies done in Taiwan [29] and Germany population [30], a higher risk of OC development in the presence of Arg/Arg compared with those with Pro/Pro was reported. Another study done in South India suggested a strong association of both Arg/Pro and Pro/Pro of codon 72 of the P53 polymorphism with tumor progression [31].

The previous variations might be attributable to other environmental factors, which may contribute to the carcinogenic mechanisms (OC) [32].

The current study results showed no association between both HPV 16 and 18 genotypes and OSCC or leukoplakia. These negative results might be owing to uncommon sexual behavior as a route of transmission in our country. This behavior is owing to religious and social considerations. Moreover, the negative results might be owing to the limited sample size.

We observed that frequency of SCC was higher in the age group more than or equal 50 years (78.6%). The frequency of leukoplakia was higher in age group less than 50 years (64.7%), with a statistically significant difference when SCC and leukoplakia were compared with the control group.

In the present study, the mean age of patients with OSCC was 58.14±12.45 years. The mean age of male patients with OSCC was 60±14.48 years and female patients with OSCC was 55.86±10.04 years. These results were similar to the study done in north-eastern Nigeria [33] but different from the studies done in India [34] and the Netherlands [35], in which the mean age of female patients with OSCC was more than males. On the contrary, in patients with leukoplakia, the mean age was 45.18±10.67 years, whereas the mean age of male patients with leukoplakia was 42.15±8.94 years and female patients with OSCC was 42 years. This observation was similar to the prevalence of leukoplakia in the world [36] but different than the study done in India, in which oral leukoplakia was predominant in older female patients [37]. This may be owing to the widespread use of tobacco and pipe among males in Upper Egypt.Moreover, the current study showed no association between OSCC and smoking, which is against other studies, which confirmed the association between tobacco use and risk for OSCC [38]. This might be owing to the presence of other environmental factors accused in the etiology of OSCC. Moreover, this explained the high percentage of OSCC among females (50%), despite none of the females were smokers.

In leukoplakia, we observed a significant association between leukoplakia and smoking, which explained the high frequency of oral leukoplakia in males, which might be owing to the higher use of tobacco and pipe among males than females in the Egyptian community.

Regarding the anatomical sites of lesions, tongue was the commonest site of SCC (46.4%), which is similar to other studies done in Netherlands [35], Iran [39], and Basque country [40]. This observation was different than other studies, in which the lip was the commonest site [41]. However, in the study done in Zimbabwe, the gingiva was the most common site for OC [42]. The high frequency of tongue SCC might be owing to poor dentition and sharp teeth causing chronic irritation of the tongue.

Up to our knowledge, there was no previous study on the association between codon 72 P53 gene polymorphism and OSCC in Egypt. On the contrary, the limited fund resources restricted the sample size in the current study, hoping to repeat it in a large population in the future.


  Conclusion Top


There is no association between codon 72 of P53 gene polymorphism and OSCC; other studies on a large sample size may be needed to confirm these results. On the contrary, HPV 16 and 18 are not associated with an increased incidence of OSCC in our study, so other environmental factors should be studied to detect the causal factors of oral carcinoma in our society.

Acknowledgements

The authors acknowledge the grant received by Assiut Faculty of Medicine Research Grant Office no (050), December 2015.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68:394–424.  Back to cited text no. 1
    
2.
El-Mofty S. Early detection of oral cancer. Egypt J Oral Maxillofac Surg 2010; 1:25–31.  Back to cited text no. 2
    
3.
Siegel R, Naishadham D, Jemal A. Cancer statistics for hispanics/latinos, 2012. CA Cancer J Clin 2012; 62:283–298.  Back to cited text no. 3
    
4.
Steele TO, Meyers A. Early detection of premalignant lesions and oral cancer. Otolaryngol Clin North Am 2011; 44:221–229.  Back to cited text no. 4
    
5.
Fischer M, Quaas M, Steiner L, Engeland K. The p53-p21-DREAM-CDE/CHR pathway regulates G2/M cell cycle genes. Nucleic Acids Res 2015; 44:164–174.  Back to cited text no. 5
    
6.
Matakidou A, Eisen T, Houlston RS. TP53 polymorphisms and lung cancer risk: a systematic review and meta‐analysis. Mutagenesis 2003; 18:377–385.  Back to cited text no. 6
    
7.
Dumont P, Leu J-J, Della Pietra III AC, George DL, Murphy M. The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 2003; 33:357.  Back to cited text no. 7
    
8.
Puente XS, Velasco G, Gutiérrez-Fernández A, Bertranpetit J, King M-C, López-Otín C. Comparative analysis of cancer genes in the human and chimpanzee genomes. BMC Genomics 2006; 7:15.  Back to cited text no. 8
    
9.
Thomas M, Kalita A, Labrecque S, Pim D, Banks L, Matlashewski G. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Mol Cell Biol 1999; 19:1092–1100.  Back to cited text no. 9
    
10.
Syrjänen S. The role of human papillomavirus infection in head and neck cancers. Ann Oncol 2010; 21:vii243–vii245.  Back to cited text no. 10
    
11.
Hou J, Gu Y, Hou W, Wu S, Lou Y, Yang W et al. P53 codon 72 polymorphism, human papillomavirus infection, and their interaction to oral carcinoma susceptibility. BMC Genet 2015; 16:72.  Back to cited text no. 11
    
12.
Van der Waal I. Potentially malignant disorders of the oral and oropharyngeal mucosa; terminology, classification and present concepts of management. Oral Oncol 2009; 45:317–323.  Back to cited text no. 12
    
13.
Neville BW, Damm DD, Allen CM, Chi AC. Oral and maxillofacial pathology. St. Louis, Missouri: Elsevier Health Sciences; 2015.  Back to cited text no. 13
    
14.
Martorell-Calatayud A, Botella-Estrada R, Bagán-Sebastián JV, Sanmartín-Jiménez O, Guillén-Barona C. Oral leukoplakia: clinical, histopathologic, and molecular features and therapeutic approach. Actas Dermo-Sifiliográficas (English Ed) 2009; 100:669–684.  Back to cited text no. 14
    
15.
Fukuda M, Ohmori Y, Sakashita H. The role of tumor microenvironment in oral cancer. Tumor Microenviron Myelomonocytic Cells, , Dr. Subhra Biswas (Ed.), 2012. ISBN: 978-953- 51-0439-1.  Back to cited text no. 15
    
16.
Dissanayaka WL, Pitiyage G, Kumarasiri PVR, Liyanage RLPR, Dias KD, Tilakaratne WM. Clinical and histopathologic parameters in survival of oral squamous cell carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol 2012; 113:518–525.  Back to cited text no. 16
    
17.
Dalianis T. Human papillomavirus and oropharyngeal cancer, the epidemics, and significance of additional clinical biomarkers for prediction of response to therapy. Int J Oncol 2014; 44:1799–1805.  Back to cited text no. 17
    
18.
Hassan NMM, Tada M, Hamada J, Kashiwazaki H, Kameyama T, Akhter R et al. Presence of dominant negative mutation of TP53 is a risk of early recurrence in oral cancer. Cancer Lett 2008; 270:108–119.  Back to cited text no. 18
    
19.
Kuo MY, Huang J, Hsu H, Chiang C, Kok S, Kuo Y et al. Infrequent p53 mutations in patients with areca quid chewing‐associated oral squamous cell carcinomas in Taiwan. J Oral Pathol Med 1999; 28:221–225.  Back to cited text no. 19
    
20.
Acha-Sagredo A, Ruesga MT, Rodriguez C, Aguirregaviria JI, de Pancorbo MM, Califano JA et al. p53 mutation is rare in oral mucosa brushings from patients previously treated for a head and neck squamous cell carcinoma. Oral Oncol 2009; 45:661–664.  Back to cited text no. 20
    
21.
Shen H, Zheng Y, Sturgis EM, Spitz MR, Wei Q. P53 codon 72 polymorphism and risk of squamous cell carcinoma of the head and neck: a case-control study. Cancer Lett 2002; 183:123–130.  Back to cited text no. 21
    
22.
Sina M, Pedram M, Ghojazadeh M, Kochaki A, Aghbali A. P53 gene codon 72 polymorphism in patients with oral squamous cell carcinoma in the population of northern Iran. Med Oral Patol Oral Cir Bucal 2014; 19:e550.  Back to cited text no. 22
    
23.
Shen H, Solari A, Wang X, Zhang Z, Xu Y, Wang L et al. P53 codon 72 polymorphism and risk of gastric cancer in a Chinese population. Oncol Rep 2004; 11:1115–1120.  Back to cited text no. 23
    
24.
Bonafé M, Ceccarelli C, Farabegoli F, Santini D, Taffurelli M, Barbi C et al. Retention of the p53 codon 72 arginine allele is associated with a reduction of disease-free and overall survival in arginine/proline heterozygous breast cancer patients. Clin Cancer Res 2003; 9:4860–4864.  Back to cited text no. 24
    
25.
Storey A, Thomas M, Kalita A, Harwood C, Gardiol D, Mantovani F et al. Role of a p53 polymorphism in the development of human papilloma-virus-associated cancer. Nature 1998; 393:229.  Back to cited text no. 25
    
26.
Wang Y-C, Lee H-S, Chen S-K, Chang Y-Y, Chen C-Y. Prognostic significance of p53 codon 72 polymorphism in lung carcinomas. Eur J Cancer 1999; 35:226–230.  Back to cited text no. 26
    
27.
Yu M, Yang S, Chiu Y, Chiang Y, Liaw Y, Chen C. Ap53genetic polymorphism as a modulator of hepatocellular carcinoma risk in relation to chronic liver disease, familial tendency, and cigarette smoking in hepatitis B carriers. Hepatology 1999; 29:697–702.  Back to cited text no. 27
    
28.
Mabrouk I, Baccouche S, El‐Abed RYM, Mokdad‐Gargouri R, Mosbah ALI, Saïd S et al. No evidence of correlation between p53 codon 72 polymorphism and risk of bladder or breast carcinoma in Tunisian patients. Ann N Y Acad Sci 2003; 1010:764–770.  Back to cited text no. 28
    
29.
Bau D-T, Tsai M-H, Lo Y-L, Hsu C-M, Tsai Y, Lee C-C et al. Association of p53 and p21 (CDKN1A/WAF1/CIP1) polymorphisms with oral cancer in Taiwan patients. Anticancer Res 2007; 27:1559–1564.  Back to cited text no. 29
    
30.
Brant O, Hoffmann M, Kanappilly A, Goeroegh T, Gottschlich S. P53 codon 72 polymorphism in squamous cell carcinoma of the head and neck region. Anticancer Res 2007; 27:3301–3305.  Back to cited text no. 30
    
31.
Addala L, Kalyan K, Mohan R, Anjaneyulu V, Sadanani MD. P5 3 codon 72 gene polymorphism and risk of oral squamous cell carcinoma i n south indian population: a case-control study. J Cancer Sci Ther 2012; 4:188–192.  Back to cited text no. 31
    
32.
Zhuo X-L, Li Q, Zhou Y, Cai L, Xiang Z-L, Yuan W et al. Study on TP53 codon 72 polymorphisms with oral carcinoma susceptibility. Arch Med Res 2009; 40:625–634.  Back to cited text no. 32
    
33.
Otoh EC, Johnson NW, Olasoji HO, Danfillo IS, Adeleke OA. Intra‐oral carcinomas in Maiduguri, north‐eastern Nigeria. Oral Dis 2005; 11:379–385.  Back to cited text no. 33
    
34.
Sankarnarayanan R. Oral cancer in India: an epidemiologic and clinical review. Oral Surg Oral Med Oral Pathol 1990; 69:325–330.  Back to cited text no. 34
    
35.
Jovanovic A, Schulten EAJM, Kostense PJ, Snow GB, van der Waal I. Squamous cell carcinoma of the lip and oral cavity in The Netherlands; an epidemiological study of 740 patients. J Cranio-Maxillofacial Surg 1993; 21:149–152.  Back to cited text no. 35
    
36.
Napier SS, Speight PM. Natural history of potentially malignant oral lesions and conditions: an overview of the literature. J Oral Pathol Med 2008; 37:1–10.  Back to cited text no. 36
    
37.
Mishra M, Mohanty J, Sengupta S, Tripathy S. Epidemiological and clinicopathological study of oral leukoplakia. Indian J Dermatol Venereol Leprol 2005; 71:161.  Back to cited text no. 37
[PUBMED]  [Full text]  
38.
Singh A, Tripathi P. Potential of natural products for the prevention of oral cancer. Anticancer Plants Nat. Prod. Biotechnol. Singapore: Springer; 2018. 41–66.  Back to cited text no. 38
    
39.
Sargeran K, Murtomaa H, Safavi SMR, Vehkalahti M, Teronen O. Malignant oral tumors in Iran: ten-year analysis on patient and tumor characteristics of 1042 patients in Tehran. J Craniofac Surg 2006; 17:1230–1233.  Back to cited text no. 39
    
40.
Izarzugaza MI, Esparza H, Aguirre JM. Epidemiological aspects of oral and pharyngeal cancers in the Basque Country. J Oral Pathol Med 2001; 30:521–526.  Back to cited text no. 40
    
41.
Howell RE, Wright BA, Dewar R. Trends in the incidence of oral cancer in Nova Scotia from1983 to 1997. Oral Surgery Oral Med Oral Pathol Oral Radiol Endodontol 2003; 95:205–212.  Back to cited text no. 41
    
42.
Chidzonga MM. Oral malignant neoplasia: a survey of 428 cases in two Zimbabwean hospitals. Oral Oncol 2006; 42:177–183.  Back to cited text no. 42
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Patients and methods
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed106    
    Printed10    
    Emailed0    
    PDF Downloaded28    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]